Coding
Part:BBa_K3807017:Experience
Designed by: Viktoriia Belousova Group: iGEM21_KU_Leuven (2021-10-01)
This experience page is provided so that any user may enter their experience using this part.
Please enter
how you used this part and how it worked out.
Applications of BBa_K3807017
sfGFP was fused to a TetA gene through a flexible linker (encoded by GGATCCGCTGGCTCCGCTGCTGGTTCTGGCGAATTC). sfGFP serves as a reporter, whose expression level is measured by a spectrophotometer or flow-cytometer, for the expression level of TetA. The quantitative measurement of protein expression level was used to report the characteristics of theophylline riboswitches put directly upstream of this TetA-sfGFP gene.
User Reviews
UNIQ9906b988a1506683-partinfo-00000000-QINU UNIQ9906b988a1506683-partinfo-00000001-QINU